Journal: Cellular and Molecular Immunology

Article Title: Cellular response to influenza virus infection: a potential role for autophagy in CXCL10 and interferon-alpha induction

doi: 10.1038/cmi.2010.25

Figure Lengend Snippet: Knockdown of Atg5 protein by siRNA oligos. Human blood macrophages were transfected with siAtg5 or siCtrl at 100 and 200 nM. At 48 hour post-transfection, whole-cell lysates were harvested and Atg5 expression was measured by western blot with antibodies specific to Atg5. Actin was used as a loading control. Densities of the protein bands were determined with Bio-Rad Quantity One imaging software. The Atg5 intensity values were normalized to the corresponding actin levels. The values in parentheses are the relative normalized intensities compared to those of the siCtrl-transfected cells. The results shown are representative figures from three independent experiments. siAtg5, small interfering RNA oligos specific to Atg5; siCtrl, non-targeting control oligos; siRNA, small interfering RNA.

Article Snippet: Specific antibodies against LC3B, Atg5 and phosphorylated and unphosphorylated forms of p70S6 kinase (p70S6K) were purchased from Cell Signaling Technology (Beverly, MA, USA), while antibodies specific to p62 and actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Knockdown, Transfection, Expressing, Western Blot, Control, Imaging, Software, Small Interfering RNA

Journal: Cellular and Molecular Immunology

Article Title: Cellular response to influenza virus infection: a potential role for autophagy in CXCL10 and interferon-alpha induction

doi: 10.1038/cmi.2010.25

Figure Lengend Snippet: Involvement of Atg5 in H1N1 and H9N2/G1 virus-induced autophagy. siAtg5- or siCtrl-transfected macrophages were mock-infected or infected with H1N1 or H9N2/G1. Atg5 and LC3B II levels were examined by western blot. Actin was used as a loading control. Densities of the protein bands were determined with Bio-Rad Quantity One imaging software. The values in parentheses are the relative intensities of Atg5 or LC3B II levels compared to those of actin. The results shown are representative figures from three independent experiments. siAtg5, small interfering RNA oligos specific to Atg5; siCtrl, non-targeting control oligos; siRNA, small interfering RNA.

Article Snippet: Specific antibodies against LC3B, Atg5 and phosphorylated and unphosphorylated forms of p70S6 kinase (p70S6K) were purchased from Cell Signaling Technology (Beverly, MA, USA), while antibodies specific to p62 and actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Virus, Transfection, Infection, Western Blot, Control, Imaging, Software, Small Interfering RNA

Journal: Cellular and Molecular Immunology

Article Title: Cellular response to influenza virus infection: a potential role for autophagy in CXCL10 and interferon-alpha induction

doi: 10.1038/cmi.2010.25

Figure Lengend Snippet: Inhibition of autophagy suppressed influenza-induced CXCL10 and IFN-α expression. Macrophages were pre-treated with 3-MA (10 mM) before infection with H1N1 ( a ) or H9N2/G1 ( b ). CXCL10 mRNA expression at 3 h.p.i. was examined by TaqMan gene expression assay; n =3. Macrophages were transfected with siAtg5 or siCtrl at 200 nM. At 48 hour post-transfection, cells were infected with H1N1 ( c ) or H9N2/G1 ( d ). The relative CXCL10 mRNA levels were examined at 3 h.p.i. by TaqMan gene expression assay; n =3. Relative mRNA levels of IFN-α1, -α2 and -α8 in siRNA-transfected cells with H9N2/G1 infections were examined by TaqMan gene expression assay ( e ); n =3. Data represent the percentages of CXCL10 or IFN-α expression from 3-MA-treated or siAtg5-transfected cells relative to the mock-treated or siCtrl-transfected cells, respectively. * P <0.05, # P <0.01. h.p.i., hour post-infection; IFN, interferon; siAtg5, small interfering RNA oligos specific to Atg5; siCtrl, non-targeting control oligos; siRNA, small interfering RNA; 3-MA, 3-methyladenine.

Article Snippet: Specific antibodies against LC3B, Atg5 and phosphorylated and unphosphorylated forms of p70S6 kinase (p70S6K) were purchased from Cell Signaling Technology (Beverly, MA, USA), while antibodies specific to p62 and actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Inhibition, Expressing, Infection, Gene Expression, Transfection, Small Interfering RNA, Control

Journal: Cellular and Molecular Immunology

Article Title: Cellular response to influenza virus infection: a potential role for autophagy in CXCL10 and interferon-alpha induction

doi: 10.1038/cmi.2010.25

Figure Lengend Snippet: Atg5 knockdown suppressed H9N2/G1-induced CXCL10 and IFN-α protein expression. Macrophages were transfected with siAtg5 or siCtrl at 200 nM. At 48 hour post-transfection, cells were infected with H9N2/G1. Quantities of CXCL10 ( a ) ( n =4) and IFN-α ( b ) ( n =5) in the culture supernatants at 8 h.p.i. were measured by ELISA. The data represent the percentage of CXCL10 and IFN-α expression from siAtg5-transfected cells relative to siCtrl-transfected cells. * P <0.05, # P <0.01. h.p.i., hour post-infection; IFN, interferon; siAtg5, small interfering RNA oligos specific to Atg5; siCtrl, non-targeting control oligos.

Article Snippet: Specific antibodies against LC3B, Atg5 and phosphorylated and unphosphorylated forms of p70S6 kinase (p70S6K) were purchased from Cell Signaling Technology (Beverly, MA, USA), while antibodies specific to p62 and actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Knockdown, Expressing, Transfection, Infection, Enzyme-linked Immunosorbent Assay, Small Interfering RNA, Control

Journal: Oncotarget

Article Title: Inhibition of autophagy potentiates pemetrexed and simvastatin-induced apoptotic cell death in malignant mesothelioma and non-small cell lung cancer cells

doi:

Figure Lengend Snippet: Cells were treated with 1 μM pemetrexed and 5 μM simvastatin in the absence or presence of the autophagy inhibitors 1 mM 3-MA A. ATG5 siRNA C. 50 nM bafilomycin A E. and 10 μM E64d/pepstatin A G. The cell lysates were subjected to 12% SDS-PAGE to measure the expression of indicated proteins. B, D, F. and H. Apoptosis was evaluated as described in Figure . The data represent the mean ± SD of three independent experiments. * p < 0.01 compared with the control, ## p < 0.05 compared to the pemetrexed and simvastatin group.

Article Snippet: Pooled small interfering RNA (siRNA) oligonucleotides against ATG5 were purchased from Cell Signaling Technology.

Techniques: SDS Page, Expressing, Control

Journal: International Journal of Molecular Sciences

Article Title: Inhibition of Autophagy by Deguelin Sensitizes Pancreatic Cancer Cells to Doxorubicin

doi: 10.3390/ijms18020370

Figure Lengend Snippet: Autophagy has a pro-survival role in doxorubicin-induced cell death. ( A , B ) Mia PaCa-2 and Panc-1 cells were treated with doxorubicin (2.5 μM) in the presence or absence of CQ (10 μM). The percentage of Annexin V positive cells was recorded. Cleaved PARP and cleaved caspase-3 levels were also analyzed by western blot; ( C ) Mia PaCa-2 and Panc-1 cells were transfected with siRNA against the essential autophagy gene Atg5 or with a scrambled siRNA. Atg5 mRNA and protein expression levels were detected by real-time quantitative PCR and western blot, respectively. Results are presented as the means ± SD; ( D ) Western blot analysis of autophagic markers (LC3-II and p62) and apoptotic markers (cleaved PARP and cleaved caspase-3) from Mia PaCa-2 and Panc-1 cells transfected with the indicated siRNAs followed by doxorubicin treatment for 24 h; ( E ) Evaluation of apoptosis in Mia PaCa-2 and Panc-1 cells following suppression of autophagy by knockdown of Atg5 and treatment with doxorubicin (2.5 μM) for 24 h. GAPDH from a similarly loaded gel is shown as loading control.

Article Snippet: Mia PaCa-2 and Panc-1 cells were grown in 6-well plates and transfected with 50 nM siRNA using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. siRNA targeting Atg5 mRNA (AGUGAACAUCUGAGCUACCCGGAUA) and siRNA control duplexes were purchased from RiboBio company (Guangzhou, China).

Techniques: Western Blot, Transfection, Expressing, Real-time Polymerase Chain Reaction